cloning site Search Results


precr n  (ArcticZymes)
93
ArcticZymes precr n
Precr N, supplied by ArcticZymes, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/precr n/product/ArcticZymes
Average 93 stars, based on 1 article reviews
precr n - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
human purified recombinant cd81 antigen  (OriGene)
96
OriGene human purified recombinant cd81 antigen
Human Purified Recombinant Cd81 Antigen, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human purified recombinant cd81 antigen/product/OriGene
Average 96 stars, based on 1 article reviews
human purified recombinant cd81 antigen - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier
cag lox cat lox vector  (Addgene inc)
93
Addgene inc cag lox cat lox vector
(A) <t>SC-CAG-AT2R</t> animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; <t>CAG-CAT</t> flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.
Cag Lox Cat Lox Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cag lox cat lox vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
cag lox cat lox vector - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
cloning plasmids  (Addgene inc)
92
Addgene inc cloning plasmids
(A) <t>SC-CAG-AT2R</t> animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; <t>CAG-CAT</t> flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.
Cloning Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cloning plasmids/product/Addgene inc
Average 92 stars, based on 1 article reviews
cloning plasmids - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier
multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)  (Oligos Etc)
90
Oligos Etc multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)
(A) <t>SC-CAG-AT2R</t> animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; <t>CAG-CAT</t> flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.
Multiple Cloning Site Oligos 5′Aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (Seq Id No: 18), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)/product/Oligos Etc
Average 90 stars, based on 1 article reviews
multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
sap i cloning site  (ATUM Bio)
90
ATUM Bio sap i cloning site
(A) <t>SC-CAG-AT2R</t> animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; <t>CAG-CAT</t> flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.
Sap I Cloning Site, supplied by ATUM Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sap i cloning site/product/ATUM Bio
Average 90 stars, based on 1 article reviews
sap i cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab)  (Promega)
90
Promega palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab)
(A) <t>SC-CAG-AT2R</t> animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; <t>CAG-CAT</t> flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.
Palter Ab 3.2 Kb Hind Iii Kpni Fragment Containing Arsab Genes Cloned Into The Multiple Cloning Site Of Palter™21, (Arsab), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab)/product/Promega
Average 90 stars, based on 1 article reviews
palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
goldengate cloning sites  (GoldenGate Software Inc)
90
GoldenGate Software Inc goldengate cloning sites
(A) <t>SC-CAG-AT2R</t> animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; <t>CAG-CAT</t> flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.
Goldengate Cloning Sites, supplied by GoldenGate Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/goldengate cloning sites/product/GoldenGate Software Inc
Average 90 stars, based on 1 article reviews
goldengate cloning sites - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
multiple cloning site  (Promega)
90
Promega multiple cloning site
(A) <t>SC-CAG-AT2R</t> animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; <t>CAG-CAT</t> flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.
Multiple Cloning Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site/product/Promega
Average 90 stars, based on 1 article reviews
multiple cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
gene fragment encoding the mu6 promoter and a bsmbi cloning site  (Twist Bioscience)
90
Twist Bioscience gene fragment encoding the mu6 promoter and a bsmbi cloning site
(A) <t>SC-CAG-AT2R</t> animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; <t>CAG-CAT</t> flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.
Gene Fragment Encoding The Mu6 Promoter And A Bsmbi Cloning Site, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene fragment encoding the mu6 promoter and a bsmbi cloning site/product/Twist Bioscience
Average 90 stars, based on 1 article reviews
gene fragment encoding the mu6 promoter and a bsmbi cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
flag tag and part of the multiple cloning site  (Promega)
90
Promega flag tag and part of the multiple cloning site
(A) <t>SC-CAG-AT2R</t> animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; <t>CAG-CAT</t> flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.
Flag Tag And Part Of The Multiple Cloning Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/flag tag and part of the multiple cloning site/product/Promega
Average 90 stars, based on 1 article reviews
flag tag and part of the multiple cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
dna fragment encoding mmbp and a multiple cloning site  (GenScript corporation)
90
GenScript corporation dna fragment encoding mmbp and a multiple cloning site
(A) <t>SC-CAG-AT2R</t> animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; <t>CAG-CAT</t> flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.
Dna Fragment Encoding Mmbp And A Multiple Cloning Site, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna fragment encoding mmbp and a multiple cloning site/product/GenScript corporation
Average 90 stars, based on 1 article reviews
dna fragment encoding mmbp and a multiple cloning site - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


(A) SC-CAG-AT2R animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; CAG-CAT flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.

Journal: bioRxiv

Article Title: Angiotensin II Type 2 Receptor Potentiates Skeletal Muscle Satellite Cell Differentiation via the GSK3β/β-catenin Pathway

doi: 10.1101/2022.09.30.510328

Figure Lengend Snippet: (A) SC-CAG-AT2R animal model. Left panel: In SC-CAG-AT2R (Pax7 CreER/+ ; CAG-CAT flox -AT2R; R26 LSL-EYFP ) mice, neither AT2R nor EYFP is expressed due to the presence of stop codons upstream of AT2R or EYFP. CreER is expressed specifically in SCs under the control of Pax7 promoter but inactive in the absence of tamoxifen (Tmx). Right panel: Upon tamoxifen administration, CreER becomes active and stop codons are removed via Cre-mediated recombination, allowing AT2R or EYFP to be expressed specifically in SCs. (B) Various tissues and SCs were harvested from control (Pax7CreER/+; R26 LSL-EYFP ) and SC-CAG-AT2R mice ±Tmx administration. AT2R mRNA expression was quantified by qRT-PCR. N=4; mean±SEM; *p<0.05. (C) Primary SCs were collected from SC-CAG-AT2R and control SC-EYFP mice, cultured in vitro , and induced to differentiate for 2 days. Cells were harvested before (d0) and after 2 days of differentiation, and gene expression was analyzed by qRT-PCR. N=5; mean±SEM; *p<0.05; **p<0.01. (D, E) SCs were collected as in (C), and myofiber formation was visualized in bright field (top panels in D) and by EYFP fluorescence (bottom panels in D), and myofiber diameter was quantified (E). N=4; mean±SEM; *p<0.05. (F) SCs were collected as in (A), and AT2R and myogenin protein expression was measured by immunoblotting.

Article Snippet: The amplified sequence was subcloned into CAG-lox-CAT-lox vector(gift from Jeffrey Robbins; Addgene plasmid # 53959) using BamHI cloning site.

Techniques: Animal Model, Expressing, Quantitative RT-PCR, Cell Culture, In Vitro, Fluorescence, Western Blot

(A) Map of mouse AT2R gene (top) and transgenic vector for CAG-CAT flox -AT2R mice (bottom). (B) Southern blotting of AT2R gene in four CAG-CAT flox -AT2R founder lines (lines 888, 898, 900 and 902) with the probe indicated in (A). Genomic DNA of these animals were digested with BamHI. The location of the restriction enzyme digestion sites and the predicted DNA fragment sizes are shown (A). Copy numbers from each line are shown at the bottom. (C) Primary SCs were collected from SC-CAG-AT2R, SC-EYFP and negative control Pax7 +/+ ; R26 LSL-EYFP/+ mice, and bright field and EYFP fluorescence images are shown.

Journal: bioRxiv

Article Title: Angiotensin II Type 2 Receptor Potentiates Skeletal Muscle Satellite Cell Differentiation via the GSK3β/β-catenin Pathway

doi: 10.1101/2022.09.30.510328

Figure Lengend Snippet: (A) Map of mouse AT2R gene (top) and transgenic vector for CAG-CAT flox -AT2R mice (bottom). (B) Southern blotting of AT2R gene in four CAG-CAT flox -AT2R founder lines (lines 888, 898, 900 and 902) with the probe indicated in (A). Genomic DNA of these animals were digested with BamHI. The location of the restriction enzyme digestion sites and the predicted DNA fragment sizes are shown (A). Copy numbers from each line are shown at the bottom. (C) Primary SCs were collected from SC-CAG-AT2R, SC-EYFP and negative control Pax7 +/+ ; R26 LSL-EYFP/+ mice, and bright field and EYFP fluorescence images are shown.

Article Snippet: The amplified sequence was subcloned into CAG-lox-CAT-lox vector(gift from Jeffrey Robbins; Addgene plasmid # 53959) using BamHI cloning site.

Techniques: Transgenic Assay, Plasmid Preparation, Southern Blot, Negative Control, Fluorescence